Clicks2K
woj_tek shares from Edward7
23

Covid19 - dowody globalnego oszustwa

Iain Davis
COVID 19 i późniejsze reakcje rządu wydają się być częścią międzynarodowego spisku mającego na celu popełnienie oszustwa. Wydaje się, że nie ma dowodów na to, że wirus o nazwie SARS-CoV-2 wywołuje chorobę zwaną COVID 19.

Nie jestem ekspertem w dziedzinie genetyki i mogę się mylić . Jednak moją uwagę zwróciły niektóre badania opublikowane przez hiszpańskie czasopismo medyczne D-Salud-Discovery. Ich rada doradcza złożona z wybitnie wykwalifikowanych lekarzy i naukowców nadaje ich badaniom wiarygodność. Ich twierdzenie jest zdumiewające.
Genetyczne startery i sondy używane w testach RT-PCR do identyfikacji SARS-CoV-2 nie są ukierunkowane na nic konkretnego. Postępowałem zgodnie z technikami wyszukiwania przedstawionymi w tym angielskim tłumaczeniu ich raportu i mogę potwierdzić dokładność ich twierdzeń dotyczących sekwencji nukleotydów wymienionych w protokołach Światowych Organizacji Zdrowia. Możesz zrobić to samo
Stan D-Salud-Discovery nie ma testów zdolnych do identyfikacji SARS-CoV-2. W związku z tym wszystkie twierdzenia dotyczące domniemanego wpływu COVID 19 na zdrowie populacji są bezpodstawne.
Cała oficjalna narracja COVID 19 to oszustwo. Podobno nie ma naukowych podstaw dla jakiejkolwiek części tego.
Jeśli te twierdzenia są dokładne, możemy stwierdzić, że nie ma dowodów na pandemię, a jedynie jej złudzenie. Ponieśliśmy nieobliczalne straty bez wyraźnego powodu, poza ambicjami pozbawionych skrupułów despotów, którzy chcą przekształcić globalną gospodarkę i nasze społeczeństwo, aby odpowiadały ich celom.
Czyniąc to, ta „klasa pasożytów” potencjalnie popełniła niezliczone przestępstwa. Przestępstwa te mogą i powinny być ścigane i ścigane przed sądem.


IDENTYFIKACJA CO DOKŁADNIE?
Światowa Organizacja Zdrowia (WHO) sklasyfikowała COVID-19 (choroba COronaVIrus 2019). Ogłosili globalną pandemię COVID 19 11 marca 2019 roku.

Wytyczne WHO dotyczące badań laboratoryjnych stanowią

Czynnik etiologiczny [przyczyna choroby] odpowiedzialny za skupisko przypadków zapalenia płuc w Wuhan został zidentyfikowany jako nowy betakoronawirus (z tej samej rodziny co SARS-CoV i MERS-CoV) poprzez sekwencjonowanie nowej generacji (NGS) z hodowanego wirusa lub bezpośrednio z próbek otrzymanych od kilku pacjentów z zapaleniem płuc. ”

Twierdzenie WHO, że wirus SARS CoV-2 powoduje się choroby COVID-19. Twierdzą również, że ten wirus został wyraźnie zidentyfikowany przez naukowców z Wuhan.

W nowym raporcie sytuacyjnym WHO na temat koronawirusa 2019-nCov 1 stwierdzają:

Chińskie władze zidentyfikowały nowy typ koronawirusa, który został wyizolowany 7 stycznia 2020 r. …… W dniu 12 stycznia 2020 r. Chiny udostępniły krajom sekwencję genetyczną nowego koronawirusa do wykorzystania przy opracowywaniu specjalnych zestawów diagnostycznych. ”
Te dwa oświadczenia WHO wyraźnie sugerują, że wirus SARS-CoV-2 został wyizolowany (co oznacza oczyszczony do badania), a następnie zidentyfikowano sekwencje genetyczne z wyizolowanej próbki. Na tej podstawie opracowano i rozprowadzono na całym świecie zestawy diagnostyczne do testowania wirusa w miastach, miastach i społecznościach na całym świecie. Według WHO i chińskich naukowców testy te wykryją wirusa, który powoduje COVID 19.

Jednak WHO stwierdza również:

Pracując bezpośrednio na podstawie informacji o sekwencjach, zespół opracował serię testów amplifikacji genów (PCR) wykorzystywanych przez laboratoria.
Naukowcy z Wuhan opracowali testy amplifikacji genów na podstawie „informacji o sekwencji”, ponieważ nie było wyizolowanej, oczyszczonej próbki tak zwanego wirusa SARS-CoV-2. Pokazali również obrazy z mikroskopu elektronowego nowo odkrytych wirionów (kolczastej kulki białkowej zawierającej wirusowe RNA).
Jednak takie struktury białek niewyjątkowe . Wyglądają jak inne okrągłe pęcherzyki, takie jak pęcherzyki endocytarne i egzosomy.
Wirusolodzy twierdzą, że nie jest możliwe „wyizolowanie” wirusa, ponieważ replikuje się on tylko w komórkach gospodarza. Dodają, że postulaty Kocha nie mają zastosowania, ponieważ dotyczą bakterii (czyli organizmów żywych). Zamiast tego wirusolodzy obserwują cytopatogenne skutki wirusa (CPE), powodujące mutację i degradację komórek w hodowlach komórkowych.
Kiedy chińscy naukowcy po raz pierwszy zsekwencjonowali pełny genom SARS-CoV-2, zaobserwowali CPE w komórkach Vero E6 i Huh7. Vero E6 to unieśmiertelniona linia komórek małpich, a Huh7 to unieśmiertelnione komórki rakowe (rakotwórcze). Oznacza to, że były one utrzymywane in vitro (w hodowlach na płytkach Petriego) przez wiele lat.
Centralnym punktem oficjalnej historii SARS-CoV-2 jest idea, że jest to wirus odzwierzęcy, zdolny do wypełnienia dystansu między zwierzętami a ludźmi. Kiedy naukowcy z amerykańskiego CDC „zainfekowali” różne komórki nowym wirusem, zauważyli, co następuje:

Zbadaliśmy zdolność SARS-CoV-2 do infekowania i replikacji w kilku typowych liniach komórkowych naczelnych i ludzkich, w tym ludzkich komórkach gruczolakoraka (A549) [komórki płuc], ludzkich komórkach wątroby (HUH7.0) i ludzkich embrionalnych komórkach nerkowych ( HEK-293T), oprócz Vero E6 i Vero CCL81 [komórki małpy]… Nie zaobserwowano efektu cytopatycznego w żadnej z linii komórkowych z wyjątkiem komórek Vero [komórki małpy]… Komórki HUH7.0 i 293T wykazywały jedynie niewielką replikację wirusa i Komórki A549 [ludzkie komórki tkanki płucnej] były niezgodne z zakażeniem SARS-CoV-2 ”.

CDC nie zaobserwował żadnego CPE w ludzkich komórkach. Nie widzieli żadnych dowodów na to, że ten rzekomy wirus spowodował jakąkolwiek chorobę ludzką. Również ten rzekomy ludzki wirus nie wykazywał żadnej znaczącej replikacji w ludzkich komórkach, co sugeruje, że infekcja z człowieka na człowieka byłaby niemożliwa.
Dostrzegając ten problem, zespół polskich naukowców wprowadził tego sekwencjonowanego „wirusa” do ludzkich komórek nabłonka (dróg oddechowych) . Obserwowali wpływ na te kultury HAE przez 5 dni. Zauważyli znacznie większą replikację niż naukowcy z CDC, ale ostatecznie stwierdzili:
„Nie zaobserwowaliśmy żadnego uwolnienia wirusa z podstawno-bocznej strony hodowli HAE”.
Oznacza to, że nie widzieli żadnych dowodów rzekomych wirionów naruszających błonę ściany komórkowej. Ponownie sugerujemy, że ten tak zwany wirus nie jest zaraźliwy dla ludzi.
Nie jest jasne, czy SARS-CoV-2 jest ludzkim wirusem zdolnym do wywoływania choroby. Może nawet nie istnieć fizycznie. Czy to nic innego jak koncepcja oparta na predykcyjnych sekwencjach genetycznych?

PODRÓŻ ODKRYCIA
Wuhan Center for Disease Control and Prevention oraz Shanghai Public Health Clinical Center opublikowały pierwszy pełny genom SARS-CoV-2 (MN908947.1). To było wielokrotnie aktualizowane. Jednak MN908947.1 był pierwszą sekwencją genetyczną opisującą rzekomy czynnik etiologiczny COVID 19 (SARS-CoV-2).
Wszystkie kolejne roszczenia, testy, terapie, statystyki, opracowywanie szczepionek i wynikające z nich zasady są oparte na tej sekwencji. Jeśli testy tego nowego wirusa nie zidentyfikują niczego, co mogłoby wywołać chorobę u ludzi, cała narracja COVID 19 jest niczym innym jak farsą.
W badacze Wuhan, stwierdzono , że już skutecznie sztukowanych sekwencję genetyczną SARS CoV-2 razem dopasowując fragmentów znajdujących się w próbkach zawierających inne, uprzednio odkryte, sekwencji genetycznych. Z zebranych materiałów stwierdzili, że 87,1% pasuje do koronawirusa SARS (SARS-Cov). Zastosowali montaż de novo i ukierunkowaną reakcję PCR i znaleźli 29 891 par zasad, które w 79,6% pasują do SARS-CoV.
Musieli zastosować montaż de novo, ponieważ nie mieli wiedzy priori o prawidłowej kolejności lub kolejności tych fragmentów. Po prostu stwierdzenie WHO, że chińscy naukowcy wyizolowali wirusa 7 stycznia, jest fałszywe.
Zespół z Wuhan wykorzystał 40 rund amplifikacji RT-qPCR, aby dopasować fragmenty cDNA (uzupełniające się DNA zbudowane z fragmentów RNA z próbek) z opublikowanym genomem koronawirusa SARS (SARS-CoV). Niestety nie jest jasne, jak dokładny jest oryginalny genom SARS-CoV.
W 2003 roku zespół naukowców z Hongkongu przebadał 50 pacjentów z ciężkim ostrym zespołem oddechowym (SARS). Pobrali próbki od 2 z tych pacjentów i opracowali hodowlę w komórkach wątroby płodu małpy.
Stworzyli 30 klonów znalezionego materiału genetycznego. Nie mogąc znaleźć dowodów na istnienie żadnego innego znanego wirusa, tylko w jednej z tych sklonowanych próbek znaleźli sekwencje genetyczne „nieznanego pochodzenia”.

Badając te nieznane sekwencje RNA, stwierdzili, że w 57% odpowiadają one koronawirusowi bydlęcemu i mysiemu wirusowi zapalenia wątroby i wywnioskowali, że należy do rodziny Coronaviridae. Biorąc pod uwagę te sekwencje, aby sugerować nowo odkryty wirus SARS-CoV (nowe odkrycie to ambrozja dla naukowców), zaprojektowali startery RT-PCR do testowania tego nowego wirusa. Naukowcy stwierdzili:

Startery do wykrywania nowego wirusa zostały zaprojektowane do wykrywania RT-PCR tego genomu koronawirusa związanego z zapaleniem płuc u ludzi w próbkach klinicznych. Spośród 44 próbek z jamy nosowo-gardłowej dostępnych od 50 pacjentów z SARS, 22 miało dowody na obecność RNA koronawirusa związanego z zapaleniem płuc u ludzi. ”
Połowa badanych pacjentów, którzy mieli te same objawy, uzyskała wynik pozytywny dla tego nowego rzekomego wirusa. Nikt nie wie, dlaczego druga połowa uzyskała wynik negatywny na obecność tego nowego wirusa SARS-CoV. Pytanie nie zostało zadane.
Ten rzekomy wirus miał tylko 57% dopasowanie sekwencji do rzekomo znanego koronawirusa. Pozostałe 43% było po prostu „tam”. Zsekwencjonowane dane zostały wyprodukowane i zarejestrowane jako nowy genom pod numerem dostępu GenBank AY274119 .
Naukowcy z Wuhan następnie znaleźli 79,6% dopasowania sekwencji do AY274119 i dlatego nazwali go nowym szczepem SARS-CoV (2019-nCoV - ostatecznie przemianowanym na SARS-CoV-2). Nikt na żadnym etapie tego procesu nie wyprodukował żadnej wyizolowanej, oczyszczonej próbki jakiegokolwiek wirusa. Jedyne, co mieli, to dopasowania sekwencji procentowej do innych dopasowań sekwencji procentowej.

NIC NIE ODDZIELAJ
Naukowcy są bardzo zirytowani, ponieważ wciąż mówią, że wirus został wyizolowany, ale nikt im nie wierzy. Dzieje się tak, ponieważ jak dotąd nikt nie dostarczył ani jednej oczyszczonej próbki wirusa SARS-CoV-2. Zamiast tego mamy kompletny genom i, jak za chwilę odkryjemy, nie jest to szczególnie przekonujące.
Dziennikarze śledczy Torsten Engelbrecht i Konstantin Demeter zapytali niektórych naukowców, którzy twierdzili, że mają zdjęcia wirionów SARS-C0V-2, aby potwierdzić, że są to obrazy izolowanego, oczyszczonego wirusa. Żaden z nich nie mógł .
W Australii naukowcy z Instytutu Doherty ogłosili, że wyizolowali wirusa SARS-CoV-2 . Poproszeni o wyjaśnienie naukowcy powiedzieli:

„Mamy krótkie (RNA) sekwencje z testu diagnostycznego, które można wykorzystać w testach diagnostycznych”
To wyjaśnia, dlaczego rząd Australii :

Wiarygodność testów COVID-19 jest niepewna ze względu na ograniczoną bazę dowodów… Dostępne są ograniczone dowody pozwalające ocenić dokładność i użyteczność kliniczną dostępnych testów COVID-19 ”.
W Wielkiej Brytanii w lipcu grupa zaniepokojonych naukowców napisała list do premiera Wielkiej Brytanii Borisa Johnsona, w którym poprosili go o:

Przedstawić niezależnie recenzowane dowody naukowe potwierdzające, że wirus Covid-19 został wyizolowany. ”
Do tej pory nie otrzymali odpowiedzi.
Podobnie brytyjski badacz Andrew Johnson złożył wniosek o wolność informacji do Public Health England (PHE). Poprosił ich o dostarczenie mu swoich danych opisujących izolację wirusa SARS-COV-2. Na co odpowiedzieli :

PHE może potwierdzić, że nie zawiera informacji w sposób sugerowany w Twojej prośbie ”.
Kanadyjska badaczka Christine Massey wystąpiła z podobną prośbą o wolność informacji, prosząc o to samo kanadyjski rząd. Na co odpowiedział rząd Kanady :

Po dokładnym wyszukiwaniu z przykrością informujemy, że nie mogliśmy znaleźć żadnych rekordów odpowiadających na Państwa żądanie ”.
Stan panelu diagnostycznego RT-PCR Centrum Kontroli Chorób (CDC) w USA :

… Obecnie nie są dostępne ilościowo określone izolaty wirusa 2019-nCoV …… ..Wykrycie wirusowego RNA może nie wskazywać na obecność zakaźnego wirusa lub że 2019-nCoV jest czynnikiem wywołującym objawy kliniczne. ”
Ostatnia aktualizacja 13 lipca 2020 r., CDC jeszcze nie pozyskała czystej próbki wirusa od jakiegokolwiek pacjenta, u którego stwierdzono chorobę COVID-19. Otwarcie przyznają, że ich testy niekoniecznie pokazują, czy SARS-CoV-2 jest obecny lub powoduje COVID 19.
Powiedziano nam, że nic z tego nie ma znaczenia. Że jesteśmy ignorantami i po prostu nie rozumiemy wirusologii. Dlatego musimy przyjąć obrazy rzeczy, o których wiemy, że mogą być czymś innym, a sekwencje genetyczne (które mogą być czymś innym) jako ostateczny dowód, że ten wirus i choroba, którą ma wywoływać, są prawdziwe.

TESTUJĘ NIC
WHO i każdy rząd, "think tank", komitet sterujący polityką, rządowy doradca naukowy, instytucje ponadnarodowe i inne osoby, które promują oficjalną narrację o COVID 19, zapewniają, że SARS-CoV-2 powoduje COVID 19.
Chociaż nikt nigdy nie wyprodukował próbki tego rzekomego wirusa, rzekomy genom SARS-CoV-2 został opublikowany . Jest w domenie publicznej.
Mówi się, że kluczowe sekwencje genetyczne w genomie SARS-CoV-2 mają określone funkcje. Są to białka docelowe, które naukowcy testują, aby zidentyfikować obecność „wirusa” . Obejmują one:

Gen polimerazy RNA (Rd-Rp) - umożliwia replikację RNA SARS-CoV-2 w cytoplazmie komórek nabłonka chorych na COVID 19.

Gen S (Orf2) - ta glikoproteina tworzy kolec na powierzchni wirionu SARS-CoV-2, który rzekomo ułatwia wiązanie SARS-CoV-2 z receptorami ACE2 na komórkach, umożliwiając RNA wewnątrz powłoki białka wirionu (kapsyd) teraz zainfekowana komórka.

Gen E (Orf1ab) - małe białko błonowe używane w składaniu wirusa

Gen N (Orf9a) - gen nukleokapsydu, który wiąże RNA podczas tworzenia kapsydu
WHO prowadzi publicznie dostępny rejestr starterów RT-PCR i sond używanych do testowania SARS-CoV-2. Startery to specyficzne sekwencje nukleotydowe, które wiążą się (łączą) z nicią antysensowną i sensowną syntetyzowanego cDNA (nazywane odpowiednio starterami do przodu i do tyłu).
Nici cDNA rozdzielają się po podgrzaniu i przekształcają po schłodzeniu. Przed schłodzeniem sekwencje nukleotydowe zwane sondami są wprowadzane do hybrydyzacji z określonymi regionami docelowymi podejrzanego genomu wirusa. Podczas amplifikacji, gdy obszary między starterami wydłużają się, gdy starter uderza w sondę, sonda rozpada się, uwalniając fluorescencyjny lub barwnik, który następnie może zostać odczytany przez naukowców.
Naukowcy twierdzą, że to identyfikacja tych markerów dowodzi obecności SARS-CoV-2 w próbce.
Coś jeszcze, co jest publicznie dostępne, to podstawowe narzędzie wyszukiwania lokalnego dopasowania (BLAST). Dzięki temu każdy może porównać opublikowane sekwencje nukleotydów ze wszystkimi zapisanymi w genetycznej bazie danych National Institutes of Health (NIH) Stanów Zjednoczonych o nazwie GenBank. Dlatego możemy BLASTOWAĆ zastrzegane startery SARS-CoV-2, sondy i sekwencje genów docelowych.
Protokoły WHO do przodu i do tyłu oraz protokoły sondy dla domniemanego genomu wirusa SARS-CoV-2 są oparte na profilach genów RdRp, Orf1, N i E. Każdy może przeprowadzić je przez BLAST, aby zobaczyć, co znajdziemy.
Istotną sekwencją nukleotydową RdRP, używaną jako starter do przodu, jest - ATGAGCTTAGTCCTGTTG. Jeśli przeprowadzimy nukleotydowy BLAST, jest to rejestrowane jako kompletny izolat SARS-CoV-2 ze 100% dopasowaną identycznością sekwencji. Podobnie odwrotna sekwencja startera genu E - ATATTGCAGCAGTACGCACACA - ujawnia obecność sekwencji Orf1ab, która również identyfikuje SARS-CoV-2.
Jednak BLAST umożliwia także przeszukiwanie sekwencji nukleotydów genomów drobnoustrojów i człowieka. Jeśli szukamy sekwencji RdRp SARS-CoV-2, ujawnia ona 99 ludzkich chromosomów ze 100% zgodnością sekwencji. Orf1ab (gen E) zwraca 90 ze 100% identycznością sekwencji z ludzkimi chromosomami.
Robiąc to samo dla tych sekwencji, wyszukując mikroorganizmy, znajdziemy 92 drobnoustroje w 100% zgodne z genem SARS-CoV-2 E i 100 dopasowanych drobnoustrojów o 100% identyczności sekwencji z istotnym genem SARS-CoV-2 RdRp.

Ilekroć sprawdzamy tak zwane unikalne markery genetyczne dla SARS-CoV-2, zapisane w protokołach WHO, znajdujemy pełne lub wysokoprocentowe dopasowania z różnymi fragmentami ludzkiego genomu. Sugeruje to, że sekwencje genetyczne, które mają identyfikować SARS-CoV-2, nie są unikalne. Może to być wszystko, od sekwencji drobnoustrojów po fragmenty ludzkich chromosomów.
Tak zwane osoby weryfikujące fakty , takie jak projekt Health Feedback firmy Reuters , szybko odrzuciły twierdzenia tych, którzy zauważyli widoczny brak specyficzności w rzekomym genomie SARS-CoV-2.
Używając mnóstwa argumentów słomianych, takich jak „to twierdzenie sugeruje, że każdy test powinien być pozytywny” (a tak nie jest), ich próba obalenia prowadzi mniej więcej tak :

Startery są zaprojektowane tak, aby wiązały się z określonymi sekwencjami nukleotydów, które są unikalne dla wirusa. Starter do przodu może wiązać się z określonym chromosomem, ale starter do tyłu nie wiąże się z tym samym chromosomem, więc chromosom nie jest obecny w wirusie SARS-CoV-2. Ponadto, ponieważ startery przednie i przewrotne otaczają sekwencję, która ma być amplifikowana, sekwencja cDMA między starterami jest unikalna dla wirusa.
Wydaje się to celowo przeinaczać znaczenie tych ustaleń, przedstawiając argument, którego nie wysuwa nikt oprócz samych weryfikatorów faktów. Przeszukiwania BLAST pokazują, że te sekwencje docelowe nie są unikalne dla SARS-CoV-2. Nie trzeba też znajdować wszystkich celów, aby wynik był pozytywny.
Marokańscy naukowcy zbadali epidemiologię rzekomych marokańskich przypadków SARS-CoV-2. Dziewięć procent było pozytywnych dla trzech genów, osiemnaście procent było pozytywnych dla dwóch genów, a siedemdziesiąt trzy procent dla jednego. Jak przed chwilą omówiliśmy, wielu mogło być pozytywnych dla żadnego.
Jest to całkowicie zgodne z wytycznymi dotyczącymi testów WHO . Stwierdzają:
„Optymalna diagnoza obejmuje NAAT [test amplifikacji kwasu nukleinowego] z co najmniej dwoma niezależnymi od genomu celami SARS-CoV-2; jednakże na obszarach, gdzie transmisja jest powszechna, można zastosować prosty algorytm pojedynczego celu… Jeden lub więcej negatywnych wyników niekoniecznie wyklucza zakażenie SARS-CoV-2. ”
Bez względu na fałszywe argumenty dobrze finansowanych weryfikatorów faktów, jeśli startery do przodu i do tyłu identyfikują śmieci, być może jeden jest fragmentem chromosomu, a drugi sekwencją drobnoustrojów, wówczas wzmocniony region między nimi jest prawdopodobnie również śmieciami.
Argument, że RT-PCR znajduje tylko RNA, jest zwodniczy. Naturalna transkrypcja (oddzielenie nici DNA) zachodzi podczas ekspresji genów. Nikt nie mówi, że całe chromosomy lub mikroby są sekwencjonowane w rzekomym genomie SARS-CoV-2. Choć mogą, z tego, co wiemy. Mówią, że rzekome markery używane do testowania tego rzekomego wirusa nie nadają się do celu.

Testy RT-PCR nie sekwencjonują całego genomu. Poszukują przypadków specyficznej fluorescencji sondy, aby wskazać obecność sekwencji, o których mówi się, że istnieją. Sekwencje te są zdefiniowane w MN908947.1 i kolejnych aktualizacjach. Te startery i sondy nie mogą ujawnić niczego poza dopasowaniami RNA wyekstrahowanymi z niekodującego, czasami nazywanego „śmieciowym” DNA (cDNA).
Na przykład gen SARS-CoV-2 S ma być wysoce specyficzny dla genomu wirusa SARS-CoV-2. Sekwencja docelowa to - TTGGCAAAATTCAAGACTCACTTTC. Wyszukiwanie mikrobiologiczne BLAST zwraca 97 dopasowań drobnoustrojów ze 100% zgodnością sekwencji identyczności. Najniższy procent identyczności w pierwszej setce to 95%. Ludzki genom BLAST również znajduje 100% dopasowanie sekwencji do 86 fragmentów ludzkich chromosomów.
Bez względu na to, gdzie spojrzysz w domniemanym genomie SARS-CoV-2, w protokołach testowych WHO nie ma nic, co jasno identyfikuje, co to jest. Cały genom może być fałszywy. Testy nie dowodzą istnienia SARS-CoV-2. Odsłaniają jedynie zupę nieokreślonego materiału genetycznego.
Jeśli tak, ponieważ nie ma izolatów ani oczyszczonych próbek wirusa bez wykonalnego testu, nie ma dowodów na istnienie SARS-CoV-2. Dlatego nie ma żadnych dowodów na istnienie choroby zwanej COVID 19.
Oznacza to, że nie ma podstaw naukowych do jakichkolwiek twierdzeń dotyczących liczby przypadków COVID 19, przyjęć do szpitali lub wskaźników śmiertelności. Wszystkie środki podjęte w celu zwalczania tego śmiercionośnego wirusa są prawdopodobnie oparte na niczym.

KONKLUZYWNE OSZUSTWO
Oszustwo to przestępstwo. Prawnej definicji oszustwa jest:
„Jakaś oszukańcza praktyka lub umyślna sztuczka, której celem jest odebranie komuś prawa lub wyrządzenie mu krzywdy”.
Prawna definicja spisku to:
„Połączenie lub konfederacja między dwiema lub więcej osobami utworzonymi w celu popełnienia, wspólnym wysiłkiem, jakiegoś czynu niezgodnego z prawem lub przestępstwa”
Wydaje się, że ci, którzy twierdzą, że mamy do czynienia z pandemią, nie dostarczyli żadnych dowodów na to, że wirus o nazwie SARS-CoV-2 wywołuje chorobę zwaną COVID 19. Wszystkie informacje silnie sugerujące tę możliwość są łatwo dostępne w domenie publicznej. Każdy może to przeczytać.
Aby nastąpiło oszustwo, oszustwo musi być umyślne. Intencją musi być celowe pozbawienie innych ich praw lub zranienie ich w inny sposób. Jeśli istnieją dowody zmowy między osobami i organizacjami w celu popełnienia oszustwa, jest to spisek (w jurysdykcjach prawa zwyczajowego) lub wspólne przedsiębiorstwo przestępcze (JCE) na mocy prawa międzynarodowego.
Wygląda na to, że COVID 19 był celowo wykorzystywany jako casus belli do prowadzenia wojny z ludzkością. Zostaliśmy uwięzieni we własnych domach, nasza wolność wędrowania została ograniczona, wolność słowa i wypowiedzi została ograniczona, prawa do protestu zostały ograniczone, oddzielone od bliskich, nasze firmy zniszczone, zbombardowane psychicznie, w kagańcach i terroryzowane.

Co gorsza, chociaż nie ma dowodów na bezprecedensową śmiertelność ze wszystkich przyczyn, odnotowano bezprecedensowy wzrost liczby zgonów. Korelują one dokładnie ze środkami Lockdown, które doprowadziły do wycofania świadczeń zdrowotnych, za które płacimy, oraz reorientacji publicznych usług zdrowotnych na leczenie jednej domniemanej choroby z wyłączeniem wszystkich innych.
Ponadto ci, którzy przekazali historię COVID 19, sugerują, że ta domniemana choroba stanowi uzasadnienie dla całkowitej restrukturyzacji światowej gospodarki, naszych systemów politycznych, społeczeństw, kultur i samej ludzkości .
Zostać dopuszczone do udziału w ich tzw „new normal”, który jest hurtowym przekształcenie całego naszego społeczeństwa bez naszej zgody, podkreślają, że przedstawi ich warunków.
Obejmują one między innymi biometryczny nadzór nad wszystkimi, scentralizowaną kontrolę i monitorowanie wszystkich naszych transakcji, opresyjne ograniczenia biznesowe i społeczne oraz skuteczne żądanie, abyśmy nie mieli prawa do suwerenności nad naszymi własnymi ciałami. Stanowi to warunek niewolnictwa .

Nie ma wątpliwości, że zostaliśmy pozbawieni naszych praw i zranieni. W jurysdykcjach Common Law domniemywa się niewinność, ale dowody na to, że szkoda została celowo spowodowana przez międzynarodową konspirację, są przytłaczające. Niszczycielska polityka, prowadzona przez rządy na całym świecie, najwyraźniej wywodzi się z globalistycznych think tanków i ponadnarodowych instytucji na długo przed pojawieniem się tej nieistniejącej pandemii.
W jurysdykcjach Kodeksu Napoleona domniemywa się winy. Aby oskarżeni spiskowcy udowodnili swoją niewinność, muszą wykazać, że pomimo swoich niezmierzonych zasobów zbiorowo nie byli w stanie uzyskać dostępu ani zrozumieć żadnego z ogólnie dostępnych dowodów sugerujących, że COVID 19 jest mitem.
Osoby odpowiedzialne za przestępstwo spisku w celu popełnienia globalnego oszustwa powinny być sądzone. Jeśli zostaną uznani za winnych, powinni zostać uwięzieni, podczas gdy reszta z nas będzie próbowała naprawić szkody, które już wyrządzili.
off-guardian.org/…id19-evidence-of-global-fraud/
franciszek44
Chiny dokonaly tego na zlecenie MASONERII swiatowej.. Tak sie zacza rozpad swiata...
Jarujestem
Możliwe jest pomylenie covid19 z egzosomami ponieważ w mikroskopie elektronowym wyglądają tak samo. Testów potwierdzających nie wykonano na kriomikroskopie, który jest bardzo dokładny i jest wstanie pokazać wnętrze szczegóły każdego egzosomu, wtedy mielibyśmy pewność jak wygląda covid i czy nie został pomylony z egzosomami.
woj_tek shares this
2K
olek19801 shares this
2K
Covid19 - dowody globalnego oszustwa
V.R.S.
Patrząc fenomenologicznie pandemia istnieje bo wiele osób postrzega jej istnienie i bierze udział w tym zjawisku.